Introduction

This pipeline has been designed to analyse several samples or sequencing runs at the same time. It reads all samples from a samplesheet file and parallelizes computation for each of them.

Depending on your on data, you might not need to run the isoseq preprocessing. This step can be skipped by setting the --entrypoint parameter to map and starting the analysis from the mapping step. By default, the entrypoint is set to isoseq and the full pipeline is run. The generation of CCS consensuses from raw isoseq subreads can be skipped by directly providing the CCS consensuses and setting the bam_type field to ccs in the samplesheet.

Samplesheet input

You will need to create a samplesheet with information about the samples you would like to analyze before running the pipeline. Use --input parameter to specify its location.

--input '[path to samplesheet file]'

The samplesheet is a comma-separated file with 4 columns, and a header row as shown in the examples below.

Column Description
sample Sample name. Spaces in sample names are automatically converted to underscores (_).
seq_data The path to the sequence file. A BAM file for subreads, Consensus Circular Sequences or Full Length sequences. A fasta file for long reads.
pbi In case seq_data is a subreads BAM, the path to Pacbio index generated with pbindex. File’s name must be compose of bam file name with the .pbi extension. In the other cases, none
start_from The value depend of the seq_data file. ccs for subreads, lima for ccs sequences, refine for Full Length data and mapping for long reads.
sample,seq_data,pbi,start_from
sample1,sample1.subreads.bam,sample1.subreads.bam.pbi,ccs
sample2,sample2.ccs.bam,none,lima
sample3,sample3.fl.primer_5p--primer_3p.bam,none,refine
sample4,sample4.long_reads.fa.gz,none,mapping

If multiple cells have been run for the same sample, the sample ID can be used several time in the samplesheet. Each dataset will be annalysed in parallel and then be merge with TAMA.

sample,seq_data,pbi,start_from
sample1,sample1_cell1.subreads.bam,sample1_cell1.subreads.bam.pbi,ccs
sample1,sample1_cell2.subreads.bam,sample1_cell2.subreads.bam.pbi,ccs
sample2,sample1.subreads.bam,sample2.subreads.bam.pbi,ccs

Some example samplesheets can be found on the github repository.

Primer file

The primer files must be in FASTA format. The isoseq3 tutorial suggest to trim polyA from primer sequences to address LIMA polyA issue. However, this will discard a significant number of valid transcripts. To avoid this drawback, Richard Kuo suggest to conserve primer’s polyA stretches, run LIMA without --require-polya and use TAMA’s tama_flnc_polya_cleanup.py script. [twitter thread]

Terminal window
>5p
>primer_5p
TGGATTGATATGTAATACGACTCACTATAG
>primer_3p
AAAAAAAAAAAAAAAAAACGCCTGAGA

Use the –primers option to specify its location.

Terminal window
--primers '[path to primers file]'

Reference genome and annotation

The reference genome sequence is mandatory and must be in FASTA format. The reference genome annotation in GTF format is required if uLTRA aligner is selected.

Terminal window
--fasta '[path to genome file]'
--gtf '[path to annotation file]'

Aligners

Two aligners are available. The uLTRA aligner helps to detect small exons with the help of reference genome. However if no annotation is available for your genome you can use minimap2.

Terminal window
--aligner '[ultra,minimap2]'

Running the pipeline

The typical command for running the pipeline is as follows:

nextflow run nf-core/isoseq --input ./samplesheet.csv --outdir ./results --primers primers.fasta --fasta genome.fasta -profile docker

This will launch the pipeline with the docker configuration profile. See below for more information about profiles.

Note that the pipeline will create the following files in your working directory:

work # Directory containing the nextflow working files
<OUTDIR> # Finished results in specified location (defined with --outdir)
.nextflow_log # Log file from Nextflow
# Other nextflow hidden files, eg. history of pipeline runs and old logs.

If you wish to repeatedly use the same parameters for multiple runs, rather than specifying each flag in the command, you can specify these in a params file.

Pipeline settings can be provided in a yaml or json file via -params-file <file>.

Warning

Do not use -c <file> to specify parameters as this will result in errors. Custom config files specified with -c must only be used for tuning process resource specifications, other infrastructural tweaks (such as output directories), or module arguments (args).

The above pipeline run specified with a params file in yaml format:

nextflow run nf-core/isoseq -profile docker -params-file params.yaml

with:

params.yaml
input: './samplesheet.csv'
outdir: './results/'
genome: 'GRCh37'
<...>

You can also generate such YAML/JSON files via nf-core/launch.

Updating the pipeline

When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you’re running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline:

nextflow pull nf-core/isoseq

Reproducibility

It is a good idea to specify the pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you’ll be running the same version of the pipeline, even if there have been changes to the code since.

First, go to the nf-core/isoseq releases page and find the latest pipeline version - numeric only (eg. 1.3.1). Then specify this when running the pipeline with -r (one hyphen) - eg. -r 1.3.1. Of course, you can switch to another version by changing the number after the -r flag.

This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports.

To further assist in reproducibility, you can use share and reuse parameter files to repeat pipeline runs with the same settings without having to write out a command with every single parameter.

Tip

If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles.

Core Nextflow arguments

Note

These options are part of Nextflow and use a single hyphen (pipeline parameters use a double-hyphen)

-profile

Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments.

Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below.

Important

We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.

The pipeline also dynamically loads configurations from https://github.com/nf-core/configs when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is supported, please see the nf-core/configs documentation.

Note that multiple profiles can be loaded, for example: -profile test,docker - the order of arguments is important! They are loaded in sequence, so later profiles can overwrite earlier profiles.

If -profile is not specified, the pipeline will run locally and expect all software to be installed and available on the PATH. This is not recommended, since it can lead to different results on different machines dependent on the computer environment.

  • test
    • A profile with a complete configuration for automated testing
    • Includes links to test data so needs no other parameters
  • docker
    • A generic configuration profile to be used with Docker
  • singularity
    • A generic configuration profile to be used with Singularity
  • podman
    • A generic configuration profile to be used with Podman
  • shifter
    • A generic configuration profile to be used with Shifter
  • charliecloud
    • A generic configuration profile to be used with Charliecloud
  • apptainer
    • A generic configuration profile to be used with Apptainer
  • wave
    • A generic configuration profile to enable Wave containers. Use together with one of the above (requires Nextflow 24.03.0-edge or later).
  • conda
    • A generic configuration profile to be used with Conda. Please only use Conda as a last resort i.e. when it’s not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer.

-resume

Specify this when restarting a pipeline. Nextflow will use cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously. For input to be considered the same, not only the names must be identical but the files’ contents as well. For more info about this parameter, see this blog post.

You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.

-c

Specify the path to a specific config file (this is a core Nextflow command). See the nf-core website documentation for more information.

Custom configuration

Resource requests

Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the pipeline steps, if the job exits with any of the error codes specified here it will automatically be resubmitted with higher resources request (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped.

To change the resource requests, please see the max resources and customise process resources section of the nf-core website.

Custom Containers

In some cases, you may wish to change the container or conda environment used by a pipeline steps for a particular tool. By default, nf-core pipelines use containers and software from the biocontainers or bioconda projects. However, in some cases the pipeline specified version maybe out of date.

To use a different container from the default container or conda environment specified in a pipeline, please see the updating tool versions section of the nf-core website.

Custom Tool Arguments

A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default.

To learn how to provide additional arguments to a particular tool of the pipeline, please see the customising tool arguments section of the nf-core website.

nf-core/configs

In most cases, you will only need to create a custom config as a one-off but if you and others within your organisation are likely to be running nf-core pipelines regularly and need to use the same settings regularly it may be a good idea to request that your custom config file is uploaded to the nf-core/configs git repository. Before you do this please can you test that the config file works with your pipeline of choice using the -c parameter. You can then create a pull request to the nf-core/configs repository with the addition of your config file, associated documentation file (see examples in nf-core/configs/docs), and amending nfcore_custom.config to include your custom profile.

See the main Nextflow documentation for more information about creating your own configuration files.

If you have any questions or issues please send us a message on Slack on the #configs channel.

Running in the background

Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished.

The Nextflow -bg flag launches Nextflow in the background, detached from your terminal so that the workflow does not stop if you log out of your session. The logs are saved to a file.

Alternatively, you can use screen / tmux or similar tool to create a detached session which you can log back into at a later time. Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs).

Nextflow memory requirements

In some cases, the Nextflow Java virtual machines can start to request a large amount of memory. We recommend adding the following line to your environment to limit this (typically in ~/.bashrc or ~./bash_profile):

NXF_OPTS='-Xms1g -Xmx4g'