nf-core/readsimulator
A pipeline to simulate sequencing reads, such as Amplicon, Target Capture, Metagenome, and Whole genome data.
Define where the pipeline should find input data and save output data.
Path to comma-separated file containing information about the samples in the experiment.
stringYou will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See usage docs.
The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.
stringEmail address for completion summary.
stringSet this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.
MultiQC report title. Printed as page header, used for filename if not otherwise specified.
stringChoose the data types that should be simulated by the pipeline.
Option to simulate amplicon sequencing reads.
booleanOption to simulate target capture sequencing reads.
booleanOption to simulate metagenomic sequencing reads.
booleanOption to simulate wholegenomic sequencing reads.
booleanOptions for simulating amplicon sequencing reads.
Forward primer to use with crabs_insilicopcr. E.g., GTCGGTAAAACTCGTGCCAGC
stringGTCGGTAAAACTCGTGCCAGCReverse primer to use with crabs_insilicopcr. E.g., CATAGTGGGGTATCTAATCCCAGTTTG
stringCATAGTGGGGTATCTAATCCCAGTTTGSource for downloading reference database when using --amplicon parameter, but not using --fasta parameter.
stringCan be 'ncbi', 'embl', or 'bold'.
NCBI database to use when --amplicon_ref_source is set to 'ncbi'
stringnucleotideNCBI query to use when --amplicon_ref_source is set to 'ncbi'
string16S[All Fields] AND ("1"[SLEN] : "50000"[SLEN])Multiple species can be queried like this '("Mus musculus"[Organism] OR "Salmo salar"[Organism]) AND 16S[All Fields]'
Batchsize to use when --amplicon_ref_source is set to 'ncbi'
integer5000EMBL database to use when --amplicon_ref_source is set to 'embl'
stringvrt*BOLD database to use when --amplicon_ref_source is set to 'bold'. Separate database names with |
stringActinopterygii|AvesNumber of reads to be simulated per amplicon.
integer500Length of reads to be simulated.
integer130Sequencing system of reads to be simulated.
stringCan be 'GA1' for Genome Analyser I, 'GA2' for Genome Analyser II, 'HS10' for HiSeq 1000, 'HS20' for HiSeq 2000, 'HS25' for HiSeq 2500, or 'MS' for MiSeq.
Options for simulating target capture sequencing reads.
Path to FASTA probe file.
stringThis parameter is mandatory if --probe_ref_name is not specified but --target_capture is specified.
Name of supported probe. Mandatory if not using --probes parameter.
stringSupported probes are 'Tetrapods-UCE-2.5Kv1', 'Tetrapods-UCE-5Kv1', 'Actinopterygians-0.5Kv1', 'Acanthomorphs-1Kv1', 'Arachnida-1.1Kv1', 'Coleoptera-1.1Kv1', 'Diptera-2.7Kv1', 'Hemiptera-2.7Kv1', 'Hymenoptera-1.5Kv1', 'Hymenoptera-2.5Kv2', and 'Anthozoa-1.7Kv1'
Simulate 'illumina' or 'pacbio' reads.
stringMedian of fragment size at shearing.
integer2000Shape parameter of the fragment size distribution.
number6Median of fragment size distribution.
integer1300Shape parameter of the fragment size distribution.
number6Median of target fragment size (the fragment size of the data). If specified, will override '--fmedian' and '--smedian'. Othersise will be estimated.
integerShape parameter of the effective fragment size distribution.
numberNumber of fragments.
integer1000000Illumina: read length.
integer300PacBio: Average (polymerase) read length.
integer30000Illumina: Sequencing mode.
string'pe' = paired-end, 'mp' = mate-paired and 'se' = singled-end
Options for simulating metagenomic sequencing reads.
NCBI databases supported by InSilicoSeq. This option gets used when not using the --fasta or --genome parameters.
stringvirusesSupported databases are 'bacteria', 'viruses', and 'archaea'. Multiple databases can be used by providing a space seperated string.
Number of genomes to download form NCBI. This option gets used when not using the --fasta or --genome parameters.
string10Use multiple values (space seperated) if using multiple NCBI databases
Abundance distribution.
stringCan be 'uniform', 'halfnormal', 'exponential', 'lognormal', or 'zero_inflated_lognormal'
Path to tab-separated file containing abundance distribution.
stringThe first column should contain the genome and the second column should contain abundance proportion. It's recommended that the total abundace in your file equals 1.
Coverage distribution.
stringCan be 'uniform', 'halfnormal', 'exponential', 'lognormal', or 'zero_inflated_lognormal'
Path to tab-separated file containing coverage information.
stringThe first column should contain the genome and the second column should contain the coverage (e.g., use the value 20 for a coverage of 20X).
Number of reads to generate.
string1MSupported suffixes are 'k', 'K', 'm', 'M', 'g', and 'G'.
Can be 'kde', or 'basic'.
stringSet this to basic if you don't want to use a model with --metagenome_model.
Can be 'HiSeq', 'NovaSeq', or 'MiSeq'.
stringUse this option to prevent simulating reads that have abnormal GC content.
booleanOptions for simulating wholegenome sequencing reads.
The base error rate.
number0.02The outer distance between the two ends.
integer500The standard deviation.
integer50The number of read pairs.
integer1000000The length of the first reads.
integer70The length of the second reads.
integer70The rate of mutations.
number0.001The fraction of indels.
number0.15The probability that an indel is extended.
number0.3Reference genome related files and options required for the workflow.
Name of iGenomes reference.
stringIf using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. --genome GRCh38.
See the nf-core website docs for more details.
Path to reference FASTA file.
stringIf this parameter is not used, the pipeline will download a fasta file, either using the --genome parameter or by using other parameters specific to individual modes (e.g., the --amplicon mode has parameters specific to just that mode.).
Directory / URL base for iGenomes references.
strings3://ngi-igenomes/igenomesDo not load the iGenomes reference config.
booleanDo not load igenomes.config when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in igenomes.config.
Parameters used to describe centralised config profiles. These should not be edited.
Git commit id for Institutional configs.
stringmasterBase directory for Institutional configs.
stringhttps://raw.githubusercontent.com/nf-core/configs/masterIf you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.
Institutional config name.
stringInstitutional config description.
stringInstitutional config contact information.
stringInstitutional config URL link.
stringSet the top limit for requested resources for any single job.
Maximum number of CPUs that can be requested for any single job.
integer16Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1
Maximum amount of memory that can be requested for any single job.
string128.GBUse to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'
Maximum amount of time that can be requested for any single job.
string240.hUse to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'
Less common options for the pipeline, typically set in a config file.
Display help text.
booleanDisplay version and exit.
booleanMethod used to save pipeline results to output directory.
stringThe Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.
Email address for completion summary, only when pipeline fails.
stringAn email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.
Send plain-text email instead of HTML.
booleanFile size limit when attaching MultiQC reports to summary emails.
string25.MBDo not use coloured log outputs.
booleanIncoming hook URL for messaging service
stringIncoming hook URL for messaging service. Currently, MS Teams and Slack are supported.
Custom config file to supply to MultiQC.
stringCustom logo file to supply to MultiQC. File name must also be set in the MultiQC config file
stringCustom MultiQC yaml file containing HTML including a methods description.
stringBoolean whether to validate parameters against the schema at runtime
booleantrueShow all params when using --help
booleanBy default, parameters set as hidden in the schema are not shown on the command line when a user runs with --help. Specifying this option will tell the pipeline to show all parameters.
Validation of parameters fails when an unrecognised parameter is found.
booleanBy default, when an unrecognised parameter is found, it returns a warinig.
Validation of parameters in lenient more.
booleanAllows string values that are parseable as numbers or booleans. For further information see JSONSchema docs.