Define where the pipeline should find input data and save output data.

Path to comma-separated file containing information about the samples in the experiment.

required
type: string

You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See usage docs.

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Reference genome related files and options required for the workflow.

Name of iGenomes reference.

type: string

If using a reference genome configured in the pipeline using iGenomes, use this parameter to give the ID for the reference. This is then used to build the full paths for all required reference genome files e.g. --genome GRCh38.

See the nf-core website docs for more details.

Path to FASTA genome file.

type: string

This parameter is mandatory if --genome is not specified. If you don't have a BWA index available this will be generated for you automatically. Combine with --save_reference to save BWA index for future runs.

Directory / URL base for iGenomes references.

hidden
type: string
default: s3://ngi-igenomes/igenomes

Do not load the iGenomes reference config.

hidden
type: boolean

Do not load igenomes.config when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in igenomes.config.

Path to FASTA genome file.

type: string

Path to FASTA transcriptome file.

type: string

Path to gtf files

type: string

Splice sites file required for HISAT2.

type: string

Path to FASTA rRNA file.

type: string

Path to directory containing index rRNA files from riboviz pipeline.

type: string

Building indexes for alignement.

required
type: boolean
default: true

adapter sequence trimming required in the workflow.

required
type: undefined
default: AGATCGGAAGAGCACACGTCTGAA
type: boolean

Options for processing reads with unique molecular identifiers

Enable UMI-based read deduplication.

type: boolean

UMI pattern to use. Can be either 'string' (default) or 'regex'.

type: string
default: string

More details can be found in the UMI-tools documentation.

Skip the UMI extraction from the read in case the UMIs have been moved to the headers in advance of the pipeline run.

type: boolean

Regular expression pattern for UMI extraction

type: string
default: .*(?P<umi_1>.{5})(?P<discard_1>.{5})$

The regular expression pattern used to extract UMIs from the reads. The pattern must include 'Ns' for the UMIs (Unique Molecular Identifiers) and can optionally include 'Bs' for the barcodes used for demultiplexing. The value of umi_regexp is expected to be a string that represents this pattern.

Generate output stats when running "umi_tools dedup".

type: boolean

It can be quite time consuming generating these output stats - see #827.

Aligning the fastq files to transcriptome and rRNA.

Specifies the alignment algorithm to use - available options are 'star_salmon', 'star_rsem' and 'hisat2'.

type: string

Skip all of the alignment-based processes within the pipeline.

type: boolean

Sequencing center information to be added to read group of BAM files.

type: string

Where possible, save unaligned reads from either STAR, HISAT2 or Salmon to the results directory.

type: boolean

This may either be in the form of FastQ or BAM files depending on the options available for that particular tool.

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB

Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h

Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Display version and exit.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

The Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.

Email address for completion summary, only when pipeline fails.

hidden
type: string

An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB

Do not use coloured log outputs.

hidden
type: boolean

Incoming hook URL for messaging service

hidden
type: string

Incoming hook URL for messaging service. Currently, MS Teams and Slack are supported.

Custom config file to supply to MultiQC.

hidden
type: string

Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file

hidden
type: string

Custom MultiQC yaml file containing HTML including a methods description.

type: string

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

By default, parameters set as hidden in the schema are not shown on the command line when a user runs with --help. Specifying this option will tell the pipeline to show all parameters.

Validation of parameters fails when an unrecognised parameter is found.

hidden
type: boolean

By default, when an unrecognised parameter is found, it returns a warinig.

Validation of parameters in lenient more.

hidden
type: boolean

Allows string values that are parseable as numbers or booleans. For further information see JSONSchema docs.