nf-core/viralrecon
Assembly and intrahost/low-frequency variant calling for viral samples
Define where the pipeline should find input data and save output data.
Path to comma-separated file containing information about the samples you would like to analyse.
string^\S+\.csv$You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See usage docs.
NGS platform used to sequence the samples.
stringSpecifies the type of protocol used for sequencing.
stringThe output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.
stringEmail address for completion summary.
string^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.
MultiQC report title. Printed as page header, used for filename if not otherwise specified.
stringOptions for the reference genome indices used to align reads.
Name of viral reference genome.
stringYou can find the keys to specify the genomes in the Genomes config file.
Path to FASTA genome file.
string^\S+\.fn?a(sta)?(\.gz)?$If you have no genome reference available, the pipeline can build one using a FASTA file. This requires additional time and resources, so it's better to use a pre-build index if possible.
Full path to GFF annotation file.
string^\S+\.gff(\.gz)?$Full path to additional annotation file in GTF or GFF format.
string^\S+(\.gff|\.gtf)(\.gz)?$Path to directory or tar.gz archive for pre-built Bowtie2 index.
stringIf the '--protocol amplicon' parameter is provided then iVar is used to trim primer sequences after read alignment and before variant calling.
string^\S+\.bed(\.gz)?$iVar uses the primer positions relative to the viral genome supplied in this file to soft clip primer sequences from a coordinate sorted BAM file. The file must be in BED format as highlighted below:
MN908947.3 30 54 nCoV-2019_1_LEFT 60 -
MN908947.3 385 410 nCoV-2019_1_RIGHT 60 +
MN908947.3 320 342 nCoV-2019_2_LEFT 60 -
MN908947.3 704 726 nCoV-2019_2_RIGHT 60 +
If the '--protocol amplicon' parameter is provided then Cutadapt is used to trim primer sequences from FastQ files before de novo assembly.
string^\S+\.fn?a(sta)?(\.gz)?$This file must contain amplicon primer sequences in Fasta format. An example is shown below:
>nCoV-2019_1_LEFT
ACCAACCAACTTTCGATCTCTTGT
>nCoV-2019_1_RIGHT
CATCTTTAAGATGTTGACGTGCCTC
>nCoV-2019_2_LEFT
CTGTTTTACAGGTTCGCGACGT
>nCoV-2019_2_RIGHT
TAAGGATCAGTGCCAAGCTCGT
The primer set to be used for the data analysis.
stringWhere possible we are trying to collate links and settings for standard primer sets to make it easier to run the pipeline with standard keys. See https://github.com/nf-core/configs/blob/master/conf/pipeline/viralrecon/genomes.config
Version of the primer set e.g. '--primer_set artic --primer_set_version 3'.
numberWhere possible we are trying to collate links and settings for standard primer sets to make it easier to run the pipeline with standard keys. See https://github.com/nf-core/configs/blob/master/conf/pipeline/viralrecon/genomes.config
Suffix used in name field of '--primer_bed' to indicate left primer position.
string_LEFTSuffix used in name field of '--primer_bed' to indicate right primer position.
string_RIGHTIf generated by the pipeline save reference genome related files to the results folder.
booleanOptions exclusive to running the pipeline on Nanopore data using the ARTIC fieldbioinformatics pipeline.
Path to a folder containing fastq files from the Nanopore run.
stringe.g. '--fastq_dir ./20191023_1522_MC-110615_0_FAO93606_12bf9b4f/fastq_pass/'.
Path to a folder containing fast5 files from the Nanopore run.
stringe.g. '--fast5_dir ./20191023_1522_MC-110615_0_FAO93606_12bf9b4f/fast5_pass/'. Not required when running the pipeline with the '--artic_minion_caller medaka' workflow.
Sequencing summary file generated after Nanopore run completion.
string^\S+\.txt$e.g. '--sequencing_summary ./20191023_1522_MC-110615_0_FAO93606_12bf9b4f/sequencing_summary.txt'. Not required when running the pipeline with the '--artic_minion_caller medaka' workflow.
Minimum number of raw reads required per sample/barcode in order to be considered for the downstream processing steps.
integer100Minimum number of reads required after the artic guppyplex process per sample/barcode in order to be considered for the downstream processing steps.
integer10Variant caller used when running artic minion (default: 'nanopolish').
stringAligner used when running artic minion (default: 'minimap2').
stringPrimer scheme recognised by the artic minion command.
stringe.g. '--artic_scheme ncov-2019'. See https://artic.readthedocs.io/en/latest/primer-schemes/ and https://github.com/artic-network/primer-schemes/blob/master/schemes_manifest.json.
Parameter passed to artic minion and required when using the '--artic_minion_caller medaka' workflow.
stringSee https://github.com/nanoporetech/medaka
Skip pycoQC.
booleanSkip NanoPlot.
booleanOptions common to both the Nanopore and Illumina workflows in the pipeline.
Full path to Nextclade dataset required for 'nextclade run' command.
stringName of Nextclade dataset to retrieve. A list of available datasets can be obtained using the 'nextclade dataset list' command.
stringAccession id to download dataset based on a particular reference sequence. A list of available datasets can be obtained using the 'nextclade dataset list' command.
stringVersion tag of the dataset to download. A list of available datasets can be obtained using the 'nextclade dataset list' command.
stringMaximum read depth used to generate ASCIIGenome screenshots for variant locii.
integer50Maximum window size before and after variant locii used to generate ASCIIGenome screenshots.
integer50Skip freyja deep SARS-CoV-2 variant analysis using a depth weighted approach.
booleanSkip the bootstrapping module of Freyja
booleanSpecify the name where to store UShER database (default: 'freyja_db').
stringfreyja_dbSpecify a coverage depth minimum which excludes sites with coverage less than the specified value
numberUsing the depthcutoff option may result in some distinct lineages now having identical barcodes, which are grouped into the format [lineage]-like(num) (based on their shared phylogeny) in the output.
Specify the number of bootstrap repeats to do.
integer100Lineage defining barcodes, default is most recent from UShER database.
stringMetadata of lineages that match barcode, default is most recent from UShER database.
stringFile size limit when attaching MultiQC reports to summary emails.
string25.MBIf file generated by pipeline exceeds the threshold, it will not be attached.
Skip genome-wide and amplicon coverage plot generation from mosdepth output.
booleanSkip Pangolin lineage analysis for genome consensus sequence.
booleanSkip Nextclade clade assignment, mutation calling, and sequence quality checks for genome consensus sequence.
booleanSkip variant screenshot generation with ASCIIGenome.
booleanSkip generation of QUAST aggregated report for consensus sequences.
booleanSkip long table generation for reporting variants.
booleanSkip MultiQC.
booleanOptions to adjust QC, read trimming and host read filtering with Kraken2 for the Illumina workflow.
Full path to Kraken2 database built from host genome.
strings3://ngi-igenomes/test-data/viralrecon/kraken2_human.tar.gzName for host genome as recognised by Kraken2 when using the 'kraken2 build' command.
stringhumanRemove host reads identified by Kraken2 before running variant calling steps in the pipeline.
booleanRemove host reads identified by Kraken2 before running aseembly steps in the pipeline.
booleantrueSave the trimmed FastQ files in the results directory.
booleanBy default, trimmed FastQ files will not be saved to the results directory. Specify this flag (or set to true in your config file) to copy these files to the results directory when complete.
Skip FastQC.
booleanSkip Kraken2 process for removing host classified reads.
booleanSkip the initial read trimming step peformed by fastp.
booleanSkip the amplicon trimming step with Cutadapt when using --protocol amplicon.
booleanVarious options for the variant calling branch of the Illumina workflow.
Specify which variant calling algorithm you would like to use. Available options are 'ivar' (default for '--protocol amplicon') and 'bcftools' (default for '--protocol metagenomic').
stringSpecify which consensus calling algorithm you would like to use. Available options are 'bcftools' and 'ivar' (default: 'bcftools').
stringMinimum number of mapped reads below which samples are removed from further processing. Some downstream steps in the pipeline will fail if this threshold is too low.
integer1000This option unsets the '-e' parameter in 'ivar trim' to discard reads without primers.
booleanThis option sets the '-x' parameter in 'ivar trim' so that reads that occur at the specified offset positions relative to primer positions will also be trimmed.
integerThis parameter will need to be set for some amplicon-based sequencing protocols (e.g. SWIFT) as described and implemented here
Filtered duplicates reads detected by Picard MarkDuplicates from alignments.
booleanSave unaligned reads in FastQ format from Bowtie 2 to the results directory.
booleanSave mpileup files generated when calling variants with iVar variants or iVar consensus.
booleanSkip iVar primer trimming step. Not recommended for --protocol amplicon.
booleanSkip picard MarkDuplicates step.
booleantrueSkip Picard CollectMultipleMetrics steps.
booleanSkip SnpEff and SnpSift annotation of variants.
booleanSkip creation of consensus base density plots.
booleanSkip genome consensus creation step and any downstream QC.
booleanSpecify this parameter to skip all of the variant calling and mapping steps in the pipeline.
booleanVarious options for the de novo assembly branch of the Illumina workflow.
Specify which assembly algorithms you would like to use. Available options are 'spades', 'unicycler' and 'minia'.
stringspadesSpecify the SPAdes mode you would like to run (default: 'rnaviral').
stringPath to profile HMMs specific for gene/organism to enhance SPAdes assembly.
stringPath to directory or tar.gz archive for pre-built BLAST database.
stringSkip Bandage image creation for assembly visualisation.
booleanSkip blastn of assemblies relative to reference genome.
booleanSkip ABACAS process for assembly contiguation.
booleanSkip assembly report generation by PlasmidID.
booleantrueSkip generation of QUAST aggregated report for assemblies.
booleanSpecify this parameter to skip all of the de novo assembly steps in the pipeline.
booleanMinimum contig length to filter from BLAST results.
integer200Minimum percentage of contig aligned to filter from BLAST results.
number0.7Set this parameter to false to add an X at the begining or end of the primer's fasta sequence to specify cutadapt that they are non-internal 5' or 3' adapters, respectively.
booleanSee viralrecon's usage and cutadapt documentation: https://cutadapt.readthedocs.io/en/stable/guide.html#adapter-types
Set this parameter to true when the primer's for cutadapt are 3' adapters. Default value is false, as default primers are 5' adapters.
booleanSee viralrecon's usage and cutadapt documentation: https://cutadapt.readthedocs.io/en/stable/guide.html#adapter-types
Less common options for the pipeline, typically set in a config file.
Display version and exit.
booleanMethod used to save pipeline results to output directory.
stringThe Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.
Email address for completion summary, only when pipeline fails.
string^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$This works exactly as with --email, except emails are only sent if the workflow is not successful.
Send plain-text email instead of HTML.
booleanSet to receive plain-text e-mails instead of HTML formatted.
Do not use coloured log outputs.
booleanSet to disable colourful command line output and live life in monochrome.
Incoming hook URL for messaging service
stringIncoming hook URL for messaging service. Currently, only MS Teams is supported.
Custom config file to supply to MultiQC.
stringCustom logo file to supply to MultiQC. File name must also be set in the MultiQC config file
stringCustom MultiQC yaml file containing HTML including a methods description.
stringBoolean whether to validate parameters against the schema at runtime
booleantrueBase URL or local path to location of pipeline test dataset files
stringhttps://raw.githubusercontent.com/nf-core/test-datasets/Parameters used to describe centralised config profiles. These should not be edited.
Git commit id for Institutional configs.
stringmasterBase directory for Institutional configs.
stringhttps://raw.githubusercontent.com/nf-core/configs/masterIf you're running offline, nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell nextflow where to find them with the custom_config_base option. For example:
## Download and unzip the config files
cd /path/to/my/configs
wget https://github.com/nf-core/configs/archive/master.zip
unzip master.zip
## Run the pipeline
cd /path/to/my/data
nextflow run /path/to/pipeline/ --custom_config_base /path/to/my/configs/configs-master/
Note that the nf-core/tools helper package has a
downloadcommand to download all required pipeline files + singularity containers + institutional configs in one go for you, to make this process easier.
Institutional config name.
stringInstitutional config description.
stringInstitutional config contact information.
stringInstitutional config URL link.
string