Define where the pipeline should find input data and save output data.

Path to comma-separated file containing information about the samples you would like to analyse.

type: string
pattern: ^\S+\.csv$

You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See usage docs.

NGS platform used to sequence the samples.

type: string

Specifies the type of protocol used for sequencing.

type: string

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.

Options for the reference genome indices used to align reads.

Name of viral reference genome.

type: string

You can find the keys to specify the genomes in the Genomes config file.

Path to FASTA genome file.

type: string
pattern: ^\S+\.fn?a(sta)?(\.gz)?$

If you have no genome reference available, the pipeline can build one using a FASTA file. This requires additional time and resources, so it's better to use a pre-build index if possible.

Full path to GFF annotation file.

type: string
pattern: ^\S+\.gff(\.gz)?$

Path to directory or tar.gz archive for pre-built Bowtie2 index.

type: string

If the '--protocol amplicon' parameter is provided then iVar is used to trim primer sequences after read alignment and before variant calling.

type: string
pattern: ^\S+\.bed(\.gz)?$

iVar uses the primer positions relative to the viral genome supplied in this file to soft clip primer sequences from a coordinate sorted BAM file. The file must be in BED format as highlighted below:

MN908947.3 30 54 nCoV-2019_1_LEFT 60 -  
MN908947.3 385 410 nCoV-2019_1_RIGHT 60 +  
MN908947.3 320 342 nCoV-2019_2_LEFT 60 -  
MN908947.3 704 726 nCoV-2019_2_RIGHT 60 +  

If the '--protocol amplicon' parameter is provided then Cutadapt is used to trim primer sequences from FastQ files before de novo assembly.

type: string
pattern: ^\S+\.fn?a(sta)?(\.gz)?$

This file must contain amplicon primer sequences in Fasta format. An example is shown below:

>nCoV-2019_1_LEFT  
ACCAACCAACTTTCGATCTCTTGT  
>nCoV-2019_1_RIGHT  
CATCTTTAAGATGTTGACGTGCCTC  
>nCoV-2019_2_LEFT  
CTGTTTTACAGGTTCGCGACGT  
>nCoV-2019_2_RIGHT  
TAAGGATCAGTGCCAAGCTCGT  

The primer set to be used for the data analysis.

type: string

Where possible we are trying to collate links and settings for standard primer sets to make it easier to run the pipeline with standard keys. See https://github.com/nf-core/configs/blob/master/conf/pipeline/viralrecon/genomes.config

Version of the primer set e.g. '--primer_set artic --primer_set_version 3'.

type: number

Where possible we are trying to collate links and settings for standard primer sets to make it easier to run the pipeline with standard keys. See https://github.com/nf-core/configs/blob/master/conf/pipeline/viralrecon/genomes.config

Suffix used in name field of '--primer_bed' to indicate left primer position.

type: string
default: _LEFT

Suffix used in name field of '--primer_bed' to indicate right primer position.

type: string
default: _RIGHT

If generated by the pipeline save reference genome related files to the results folder.

type: boolean

Options exclusive to running the pipeline on Nanopore data using the ARTIC fieldbioinformatics pipeline.

Path to a folder containing fastq files from the Nanopore run.

type: string

e.g. '--fastq_dir ./20191023_1522_MC-110615_0_FAO93606_12bf9b4f/fastq_pass/'.

Path to a folder containing fast5 files from the Nanopore run.

type: string

e.g. '--fast5_dir ./20191023_1522_MC-110615_0_FAO93606_12bf9b4f/fast5_pass/'. Not required when running the pipeline with the '--artic_minion_caller medaka' workflow.

Sequencing summary file generated after Nanopore run completion.

type: string
pattern: ^\S+\.txt$

e.g. '--sequencing_summary ./20191023_1522_MC-110615_0_FAO93606_12bf9b4f/sequencing_summary.txt'. Not required when running the pipeline with the '--artic_minion_caller medaka' workflow.

Minimum number of raw reads required per sample/barcode in order to be considered for the downstream processing steps.

type: integer
default: 100

Minimum number of reads required after the artic guppyplex process per sample/barcode in order to be considered for the downstream processing steps.

type: integer
default: 10

Variant caller used when running artic minion (default: 'nanopolish').

type: string

Aligner used when running artic minion (default: 'minimap2').

type: string

Primer scheme recognised by the artic minion command.

type: string

e.g. '--artic_scheme ncov-2019'. See https://artic.readthedocs.io/en/latest/primer-schemes/ and https://github.com/artic-network/primer-schemes/blob/master/schemes_manifest.json.

Parameter passed to artic minion and required when using the '--artic_minion_caller medaka' workflow.

type: string

See https://github.com/nanoporetech/medaka

Skip pycoQC.

type: boolean

Skip NanoPlot.

type: boolean

Options common to both the Nanopore and Illumina workflows in the pipeline.

Full path to Nextclade dataset required for 'nextclade run' command.

type: string

Name of Nextclade dataset to retrieve. A list of available datasets can be obtained using the 'nextclade dataset list' command.

type: string

Accession id to download dataset based on a particular reference sequence. A list of available datasets can be obtained using the 'nextclade dataset list' command.

type: string

Version tag of the dataset to download. A list of available datasets can be obtained using the 'nextclade dataset list' command.

type: string

Maximum read depth used to generate ASCIIGenome screenshots for variant locii.

type: integer
default: 50

Maximum window size before and after variant locii used to generate ASCIIGenome screenshots.

type: integer
default: 50

Skip freyja deep SARS-CoV-2 variant analysis using a depth weighted approach.

type: boolean

Specify the name where to store UShER database (default: 'freyja_db').

type: string
default: freyja_db

Specify a coverage depth minimum which excludes sites with coverage less than the specified value

type: number

Using the depthcutoff option may result in some distinct lineages now having identical barcodes, which are grouped into the format [lineage]-like(num) (based on their shared phylogeny) in the output.

Specify the number of bootstrap repeats to do.

type: integer
default: 100

Lineage defining barcodes, default is most recent from UShER database.

type: string

Metadata of lineages that match barcode, default is most recent from UShER database.

type: string

Custom title for the MultiQC report.

hidden
type: string

Custom config file to supply to MultiQC.

hidden
type: string

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB

If file generated by pipeline exceeds the threshold, it will not be attached.

Skip genome-wide and amplicon coverage plot generation from mosdepth output.

type: boolean

Skip Pangolin lineage analysis for genome consensus sequence.

type: boolean

Skip Nextclade clade assignment, mutation calling, and sequence quality checks for genome consensus sequence.

type: boolean

Skip variant screenshot generation with ASCIIGenome.

type: boolean

Skip generation of QUAST aggregated report for consensus sequences.

type: boolean

Skip long table generation for reporting variants.

type: boolean

Skip MultiQC.

type: boolean

Options to adjust QC, read trimming and host read filtering with Kraken2 for the Illumina workflow.

Full path to Kraken2 database built from host genome.

type: string
default: s3://ngi-igenomes/test-data/viralrecon/kraken2_human.tar.gz

Name for host genome as recognised by Kraken2 when using the 'kraken2 build' command.

type: string
default: human

Remove host reads identified by Kraken2 before running variant calling steps in the pipeline.

type: boolean

Remove host reads identified by Kraken2 before running aseembly steps in the pipeline.

type: boolean
default: true

Save the trimmed FastQ files in the results directory.

type: boolean

By default, trimmed FastQ files will not be saved to the results directory. Specify this flag (or set to true in your config file) to copy these files to the results directory when complete.

Skip FastQC.

type: boolean

Skip Kraken2 process for removing host classified reads.

type: boolean

Skip the initial read trimming step peformed by fastp.

type: boolean

Skip the amplicon trimming step with Cutadapt when using --protocol amplicon.

type: boolean

Various options for the variant calling branch of the Illumina workflow.

Specify which variant calling algorithm you would like to use. Available options are 'ivar' (default for '--protocol amplicon') and 'bcftools' (default for '--protocol metagenomic').

type: string

Specify which consensus calling algorithm you would like to use. Available options are 'bcftools' and 'ivar' (default: 'bcftools').

type: string

Minimum number of mapped reads below which samples are removed from further processing. Some downstream steps in the pipeline will fail if this threshold is too low.

type: integer
default: 1000

This option unsets the '-e' parameter in 'ivar trim' to discard reads without primers.

type: boolean

This option sets the '-x' parameter in 'ivar trim' so that reads that occur at the specified offset positions relative to primer positions will also be trimmed.

type: integer

This parameter will need to be set for some amplicon-based sequencing protocols (e.g. SWIFT) as described and implemented here

Filtered duplicates reads detected by Picard MarkDuplicates from alignments.

type: boolean

Save unaligned reads in FastQ format from Bowtie 2 to the results directory.

type: boolean

Save mpileup files generated when calling variants with iVar variants or iVar consensus.

type: boolean

Skip iVar primer trimming step. Not recommended for --protocol amplicon.

type: boolean

Skip picard MarkDuplicates step.

type: boolean
default: true

Skip Picard CollectMultipleMetrics steps.

type: boolean

Skip SnpEff and SnpSift annotation of variants.

type: boolean

Skip creation of consensus base density plots.

type: boolean

Skip genome consensus creation step and any downstream QC.

type: boolean

Specify this parameter to skip all of the variant calling and mapping steps in the pipeline.

type: boolean

Various options for the de novo assembly branch of the Illumina workflow.

Specify which assembly algorithms you would like to use. Available options are 'spades', 'unicycler' and 'minia'.

type: string
default: spades

Specify the SPAdes mode you would like to run (default: 'rnaviral').

type: string

Path to profile HMMs specific for gene/organism to enhance SPAdes assembly.

type: string

Path to directory or tar.gz archive for pre-built BLAST database.

type: string

Skip Bandage image creation for assembly visualisation.

type: boolean

Skip blastn of assemblies relative to reference genome.

type: boolean

Skip ABACAS process for assembly contiguation.

type: boolean

Skip assembly report generation by PlasmidID.

type: boolean
default: true

Skip generation of QUAST aggregated report for assemblies.

type: boolean

Specify this parameter to skip all of the de novo assembly steps in the pipeline.

type: boolean

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Display version and exit.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

The Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.

Email address for completion summary, only when pipeline fails.

hidden
type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

This works exactly as with --email, except emails are only sent if the workflow is not successful.

Send plain-text email instead of HTML.

hidden
type: boolean

Set to receive plain-text e-mails instead of HTML formatted.

Do not use coloured log outputs.

hidden
type: boolean

Set to disable colourful command line output and live life in monochrome.

Incoming hook URL for messaging service

hidden
type: string

Incoming hook URL for messaging service. Currently, only MS Teams is supported.

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

By default, parameters set as hidden in the schema are not shown on the command line when a user runs with --help. Specifying this option will tell the pipeline to show all parameters.

Validation of parameters fails when an unrecognised parameter is found.

hidden
type: boolean

By default, when an unrecognised parameter is found, it returns a warinig.

Validation of parameters in lenient more.

hidden
type: boolean

Allows string values that are parseable as numbers or booleans. For further information see JSONSchema docs.

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h
pattern: ^(\d+\.?\s*(s|m|h|day)\s*)+$

Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

If you're running offline, nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell nextflow where to find them with the custom_config_base option. For example:

## Download and unzip the config files  
cd /path/to/my/configs  
wget https://github.com/nf-core/configs/archive/master.zip  
unzip master.zip  
  
## Run the pipeline  
cd /path/to/my/data  
nextflow run /path/to/pipeline/ --custom_config_base /path/to/my/configs/configs-master/  

Note that the nf-core/tools helper package has a download command to download all required pipeline files + singularity containers + institutional configs in one go for you, to make this process easier.

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string