Define where the pipeline should find input data and save output data.

Input FastQ files or CSV samplesheet file containing information about the samples in the experiment.

required
type: string

Use this to specify the location of your input FastQ files. For example:

--input 'path/to/data/sample_\*_{1,2}.fastq.gz'  

Alternatively, to assign different groups or to include long reads for hybrid assembly with metaSPAdes, you can specify a CSV samplesheet input file with 5 columns and the following header: sample,group,short_reads_1,short_reads_2,long_reads. See usage docs.

Specifies that the input is single-end reads.

type: boolean

By default, the pipeline expects paired-end data. If you have single-end data, you need to specify --single_end on the command line when you launch the pipeline. A normal glob pattern, enclosed in quotation marks, can then be used for --input. For example:

--single_end --input '\*.fastq'  

It is not possible to run a mixture of single-end and paired-end files in one run.

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to specify this on the command line for every run.

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Reference genome related files and options required for the workflow.

Directory / URL base for iGenomes references.

hidden
type: string
default: s3://ngi-igenomes/igenomes

Do not load the iGenomes reference config.

hidden
type: boolean

Do not load igenomes.config when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in igenomes.config.

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

If you're running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don't need them, then this is not a problem. If you do need them, you should download the files from the repo and tell Nextflow where to find them with this parameter.

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. --max_cpus 1

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB

Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. --max_memory '8.GB'

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h

Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. --max_time '2.h'

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

The Nextflow publishDir option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See Nextflow docs for details.

Email address for completion summary, only when pipeline fails.

hidden
type: string

An email address to send a summary email to when the pipeline is completed - ONLY sent if the pipeline does not exit successfully.

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB

Do not use coloured log outputs.

hidden
type: boolean

Custom config file to supply to MultiQC.

hidden
type: string

Directory to keep pipeline Nextflow logs and reports.

hidden
type: string
default: ${params.outdir}/pipeline_info

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

By default, parameters set as hidden in the schema are not shown on the command line when a user runs with --help. Specifying this option will tell the pipeline to show all parameters.

Run this workflow with Conda. You can also use '-profile conda' instead of providing this parameter.

hidden
type: boolean

Use these parameters to also enable reproducible results from the individual assembly and binning tools .

Fix number of CPUs for MEGAHIT to 1. Not increased with retries.

type: boolean

MEGAHIT only generates reproducible results when run single-threaded.

When using this parameter do not change the number of CPUs for the megahit process with a custom config file. This would result in an error.

Default: The number of CPUs is specified in the base.config file, and increased with each retry.

Fix number of CPUs used by SPAdes. Not increased with retries.

type: integer
default: -1

SPAdes is designed to be deterministic for a given number of threads. To generate reproducible results fix the number of CPUs using this parameter.

When using this parameter do not change the number of CPUs for the spades process with a custom config file. This would result in an error.

Default: -1 (the number of CPUs is specified in the base.config or in a custom config file, and increased with each retry).

Fix number of CPUs used by SPAdes hybrid. Not increased with retries.

type: integer
default: -1

SPAdes is designed to be deterministic for a given number of threads. To generate reproducible results fix the number of CPUs using this parameter.

When using this parameter do not change the number of CPUs for the spadeshybrid process with a custom config file. This would result in an error.

Default: -1 (the number of CPUs is specified in the base.config or in a custom config file, and increased with each retry).

RNG seed for MetaBAT2.

type: integer
default: 1

MetaBAT2 is run by default with a fixed seed within this pipeline, thus producing reproducible results. You can set it also to any other positive integer to ensure reproducibility. Set the parameter to 0 to use a random seed.

Specify which adapter clipping tool to use. Options: 'fastp', 'adapterremoval'

type: string

The minimum length of reads must have to be retained for downstream analysis.

type: integer
default: 15

Minimum phred quality value of a base to be qualified in fastp.

type: integer
default: 15

The mean quality requirement used for per read sliding window cutting by fastp.

type: integer
default: 15

Save reads that fail fastp filtering in a separate file. Not used downstream.

type: boolean

The minimum base quality for low-quality base trimming by AdapterRemoval.

type: integer
default: 2

Turn on quality trimming by consecutive stretch of low quality bases, rather than by window.

type: boolean

Default base-quality trimming is set to trim by 'windows', as in FastP. Specifying this flag will use trim via contiguous stretch of low quality bases (Ns) instead.

Replaces --trimwindows 4 with --trimqualities in AdapterRemoval

Forward read adapter to be trimmed by AdapterRemoval.

type: string
default: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG

Reverse read adapter to be trimmed by AdapterRemoval for paired end data.

type: string
default: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

Name of iGenomes reference for host contamination removal.

type: string

This parameter is mutually exclusive with --host_genome. Host read removal is done with Bowtie2.
Both the iGenomes FASTA file as well as corresponding, already pre-built Bowtie 2 index files will be used.

Fasta reference file for host contamination removal.

type: string

This parameter is mutually exclusive with --host_fasta. The reference can be masked. Host read removal is done with Bowtie2.

Use the --very-sensitive instead of the--sensitivesetting for Bowtie 2 to map reads against the host genome.

type: boolean

Save the read IDs of removed host reads.

type: boolean

Keep reads similar to the Illumina internal standard PhiX genome.

type: boolean

Genome reference used to remove Illumina PhiX contaminant reads.

hidden
type: string
default: ${baseDir}/assets/data/GCA_002596845.1_ASM259684v1_genomic.fna.gz

Skip removing adapter sequences from long reads.

type: boolean

Discard any read which is shorter than this value.

type: integer
default: 1000

Keep this percent of bases.

type: integer
default: 90

The higher the more important is read length when choosing the best reads.

type: integer
default: 10

The default value focuses on length instead of quality to improve assembly size.
In order to assign equal weights to read lengths and read qualities set this parameter to 1.
This might be useful, for example, to benefit indirectly from the removal of short host reads (causing lower qualities for reads not overlapping filtered short reads).

Keep reads similar to the ONT internal standard Escherichia virus Lambda genome.

type: boolean

Genome reference used to remove ONT Lambda contaminant reads.

hidden
type: string
default: ${baseDir}/assets/data/GCA_000840245.1_ViralProj14204_genomic.fna.gz

Taxonomic classification is disabled by default. You have to specify one of the options below to activate it.

Database for taxonomic binning with centrifuge.

type: string

E.g. ftp://ftp.ccb.jhu.edu/pub/infphilo/centrifuge/data/p_compressed+h+v.tar.gz.

Database for taxonomic binning with kraken2.

type: string

The database file must be a compressed tar archive that contains at least the three files hash.k2d, opts.k2d and taxo.k2d. E.g. ftp://ftp.ccb.jhu.edu/pub/data/kraken2_dbs/minikraken_8GB_202003.tgz.

Skip creating a krona plot for taxonomic binning.

type: boolean

Database for taxonomic classification of metagenome assembled genomes.

type: string

E.g. https://tbb.bio.uu.nl/bastiaan/CAT_prepare/CAT_prepare_20210107.tar.gz. This parameter is mutually exclusive with --cat_db_generate. The zipped file needs to contain a folder named \*taxonomy\* and \*database\* that hold the respective files.

Generate CAT database.

type: boolean

Download the taxonomy files from NCBI taxonomy, the nr database and generate CAT database. This parameter is mutually exclusive with --cat_db. Useful to build a CAT database with the same DIAMOND version as used for running CAT classification, avoiding compatibility problems.

Save the CAT database generated when specified by --cat_db_generate.

type: boolean

Useful to allow reproducibility, as old versions of prebuild CAT databases do not always remain accessible and underlying NCBI taxonomy and nr databases change.

GTDB database for taxonomic classification of bins with GTDB-tk.

type: string
default: https://data.gtdb.ecogenomic.org/releases/release202/202.0/auxillary_files/gtdbtk_r202_data.tar.gz

For information which GTDB reference databases are compatible with the used GTDB-tk version see https://ecogenomics.github.io/GTDBTk/installing/index.html#gtdb-tk-reference-data.

Min. bin completeness (in %) required to apply GTDB-tk classification.

type: number
default: 50

Completeness assessed with BUSCO analysis (100% - %Missing). Must be greater than 0 (min. 0.01) to avoid GTDB-tk errors. If too low, GTDB-tk classification results can be impaired due to not enough marker genes!

Max. bin contamination (in %) allowed to apply GTDB-tk classification.

type: number
default: 10

Contamination approximated based on BUSCO analysis (%Complete and duplicated). If too high, GTDB-tk classification results can be impaired due to contamination!

Min. fraction of AA (in %) in the MSA for bins to be kept.

type: number
default: 10

Min. alignment fraction to consider closest genome.

type: number
default: 0.65

Number of CPUs used for the by GTDB-Tk run tool pplacer.

type: number
default: 1

A low number of CPUs helps to reduce the memory required/reported by GTDB-Tk. See also the GTDB-Tk documentation.

Reduce GTDB-Tk memory consumption by running pplacer in a setting writing to disk.

type: boolean
default: true

Will be slower. Set to false to turn this off.

Co-assemble samples within one group, instead of assembling each sample separately.

type: boolean

Additional custom options for SPAdes.

type: string

An example is adjusting k-mers ("-k 21,33,55,77") or adding advanced options. But not -t, -m, -o or --out-prefix, because these are already in use.

Additional custom options for MEGAHIT.

type: string

An example is adjusting presets (e.g. "--presets meta-large"), k-mers (e.g. "-k 21,33,55,77") or adding other advanced options. For example, increase the minimum k-mer in the event of an error message such as "Too many vertices in the unitig graph, you may increase the kmer size to remove tons of erroneous kmers." in the MEGAHIT log file. But not --threads, --memory, -o or input read files, because these are already in use.

Skip Illumina-only SPAdes assembly.

type: boolean

Skip SPAdes hybrid assembly.

type: boolean

Skip MEGAHIT assembly.

type: boolean

Skip metaQUAST.

type: boolean

Skip Prodigal gene prediction

type: boolean

Defines mapping strategy to compute co-abundances for binning, i.e. which samples will be mapped against the assembly.

type: string
default: group

Available: all, group or own. Note that own cannot be specified in combination with --coassemble_group.

Note that specifying all without additionally specifying --coassemble_group results in n^2 mapping processes for each assembly method, where n is the number of samples.

Skip metagenome binning entirely

type: boolean

Skip MetaBAT2 Binning

type: boolean

Skip MaxBin2 Binning

type: boolean

Minimum contig size to be considered for binning and for bin quality check.

type: integer
default: 1500

For forwarding into downstream analysis, i.e. QUAST and BUSCO, and reporting.

Minimal length of contigs that are not part of any bin but treated as individual genome.

type: integer
default: 1000000

Contigs that do not fulfill the thresholds of --min_length_unbinned_contigs and --max_unbinned_contigs are pooled for downstream analysis and reporting, except contigs that also do not fullfill --min_contig_size are not considered further.

Maximal number of contigs that are not part of any bin but treated as individual genome.

type: integer
default: 100

Contigs that do not fulfill the thresholds of --min_length_unbinned_contigs and --max_unbinned_contigs are pooled for downstream analysis and reporting, except contigs that also do not fullfill --min_contig_size are not considered further.

Bowtie2 alignment mode

type: string

Bowtie2 alignment mode options, for example: --very-fast , --very-sensitive-local -N 1 , ...

Skip Prokka genome annotation.

type: boolean

Disable bin QC with BUSCO.

type: boolean

Download path for BUSCO lineage dataset, instead of using automated lineage selection.

type: string

E.g. https://busco-data.ezlab.org/v5/data/lineages/bacteria_odb10.2020-03-06.tar.gz. Available databases are listed here: https://busco-data.ezlab.org/v5/data/lineages/.

Path to local folder containing already downloaded and unpacked lineage datasets.

type: string

If provided, BUSCO analysis will be run in offline mode. Data can be downloaded from https://busco-data.ezlab.org/v5/data/ (files still need to be unpacked manually). Run in combination with automated lineage selection.

Run BUSCO with automated lineage selection, but ignoring eukaryotes (saves runtime).

type: boolean

Save the used BUSCO lineage datasets provided via --busco_reference or downloaded when not using --busco_reference or --busco_download_path.

type: boolean

Useful to allow reproducibility, as BUSCO datasets are frequently updated and old versions do not always remain accessible.

Turn on bin refinement using DAS Tool.

type: boolean

Specify single-copy gene score threshold for bin refinement.

type: number
default: 0.5

Score threshold for single-copy gene selection algorithm to keep selecting bins, with a value ranging from 0-1.

For description of scoring algorithm, see: Sieber, Christian M. K., et al. 2018. Nature Microbiology 3 (7): 836–43. https://doi.org/10.1038/s41564-018-0171-1.

Modifies DAS Tool parameter --score_threshold

Specify which binning output is sent for downstream annotation, taxonomic classification, bin quality control etc.

type: string

raw_bins_only: only bins (and unbinned contigs) from the binners.
refined_bins_only: only bins (and unbinned contigs) from the bin refinement step .
both: bins and unbinned contigs from both the binning and bin refinement steps.

Performs ancient DNA assembly validation and contig consensus sequence recalling.

Turn on/off the ancient DNA subworfklow

type: boolean

Ploidy for variant calling

type: integer
default: 1

minimum base quality required for variant calling

type: integer
default: 20

minimum minor allele frequency for considering variants

type: number
default: 0.33

minimum genotype quality for considering a variant high quality

type: integer
default: 30

minimum genotype quality for considering a variant medium quality

type: integer
default: 20

minimum number of bases supporting the alternative allele

type: integer
default: 3

PyDamage accuracy threshold

type: number
default: 0.5